Arabidopsis SNP Sequence Viewer

Chromosome : chr1 Coordinates : 3378144 - 3380228


  Query: At1g10300
Display:      Gene:      
   Chromosome:      Coordinates:      
  
 
3378144  ATGACCATCGTCTCTACTTGTTGTCCTTTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCAGATTAAAGAAGC  chr1.fa
3378144  NNNACCATCGTCTNNNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCAGNNNNNNNAANC  bay-0.fa
3378144  ATGACCATCGTCTCTACTTGTTGTCCTTTTGGTCTCTCTAATGTCANTAAGTGTATCAATTTCGTGCAGNNNNNNNNNNN  bor-4.fa
3378144  ATGACCATCGTCTCTACTTNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCANNNNNNNNNNNN  br-0.fa
3378144  NNNACCATCGTCTCTACTTNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCANNNNNNNNNNGC  bur-0.fa
3378144  ATGACCATCGTCTCTNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCAGNNNNNNNNNNC  c24.fa
3378144  ATGACCATCGTCTCTACTTGTTGTCCTTTTGGTCTCTCTAATGTCACNAAGTGTATCAATTTCGTGCAGATTAAAGNNNN  col-0.fa
3378144  NNNACCATCGTCTCTNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCAGNNNNNNNNNNN  cvi-0.fa
3378144  NNNACCATCGTCTCTACTTNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCNNNNNNNNNNNNN  est-1.fa
3378144  NNNACCATCGTCTCTACTTNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCANNNNNNNNNNNN  fei-0.fa
3378144  NNNNNNNTCGTCTNNNNNNNNNNNNNNNNTGNTCTCTCTAANNNNNNNNNNNNNATCAATTTCNNNNNNNNNNNNNNNNN  got-7.fa
3378144  ATGACCATCGTCTCTNCTTNTTGTCNTTTTGGTCTCNNNNNNNNNNNNAAGTGTATCAATTTCGTGCAGANTNNANNNNN  ler-1.fa
3378144  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNTCAATTTCNNNNNNNNNNNNNNNNN  lov-5.fa
3378144  NNNACCATCGTCTCTNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCNNNNNNNNNNNNN  nfa-8.fa
3378144  ATGACCATCGTCTCTACNNNNNNNNNNNTTGGTCTCTCTAATGTCACTANGTGTATCAATTTCGTNNNNNNNNNNNNNNN  rrs-10.fa
3378144  ATGACCATCGTCTCTACTTGTTGTCNTTTTGGTCTCTCTAATGTCANNNNNTGTATCAATTTCGTGCAGATTAAANNNNN  rrs-7.fa
3378144  NNNNCCATCGTCTNNNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACNAAGTGTATCAATTTCGTGCNNNNNNNNNNNNN  sha.fa
3378144  NNNACCATCGTCTCTNNNNNNNNNNNNNTTGGTCTCTCTAATGTCANTAAGTGTATCAATTTCGTGCNNNNNNNNNNNNN  tamm-2.fa
3378144  NNNNCCATCGTCTNNNNNNNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCNNNNNNNNNNNNN  ts-1.fa
3378144  NNNNNNATCGTCTCTNNNNNNNNNNNNNNNNNNNTCTCTAATGNNNNNNNNNNNATCAATTTCGTNNNNNNNNNNNNNNN  tsu-1.fa
3378144  NNNNCCATCGTCTCTACTTNNNNNNNNNTTGGTCTCTCTAATGTCACTAAGTGTATCAATTTCGTGCANNNNNNNNNNNN  van-0.fa
 
3378224  AAAAACAATGGTGAAATATAATTTCAAGAAGATAACAGTTGTGCCAAACGGAAAACAGTTTGTTGATATCGTTCTTTCCC  chr1.fa
3378224  AAAAANAANGGNNNNNNNNNNNNNNNNNARGANAACAGTTNNNNNNNNNCNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  bay-0.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGTGCCAAACGGAAAACAGTTNGNNNNNNNCGTTCTTTCCC  bor-4.fa
3378224  NNNAANNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  br-0.fa
3378224  AANAACAATGGNNNNNNNNNNNNNNANNNRNANAACAGTTNNNNNNNNNCNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  bur-0.fa
3378224  AAAAACAATGNNNNNNNNNNNNNNNNNNNRNNNAACAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  c24.fa
3378224  NNAAANNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGTGCCAAACGGAAAACAGTTTGNNNNNNNCGTTCTTTCCC  col-0.fa
3378224  NNNAACNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGNNNNNNNNCNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  cvi-0.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  est-1.fa
3378224  NNNNNNAATNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTNNNNNNNTNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  fei-0.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  got-7.fa
3378224  NNNANNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGTGCCAAACGGAANNNNNNNNNNNNNNNNCGTTCTTTCCC  ler-1.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  lov-5.fa
3378224  NNNNACAANNNNNNNNNNNNNNNNNNNNNRNNNAACAGTNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  nfa-8.fa
3378224  NNNAANNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNGTTCTTTCCC  rrs-10.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTGTGCCAAACGGAAAACAGNNNNNNNNNNNNGTTCTTTCCC  rrs-7.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNGTTCTTTCCC  sha.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  tamm-2.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNACAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  ts-1.fa
3378224  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNAACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  tsu-1.fa
3378224  NNNAACAATNNNNNNNNNNNNNNNNNNNNRNNTAACAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCTTTCCC  van-0.fa
 
3378304  GCACTCAGCGGCAGACACCAACTGTTGTCCACAAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  chr1.fa
3378304  GCACTCAGCGGCANRRRRRRRRRRRRRRRRNNNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  bay-0.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRACAAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  bor-4.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRANNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  br-0.fa
3378304  GCACTCAGCGNCAGRRRRRRRRRRRRRRRRANNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  bur-0.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRANNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  c24.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRACAAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  col-0.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRANNAGNGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  cvi-0.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  est-1.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  fei-0.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNNGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  got-7.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRACNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  ler-1.fa
3378304  GCACTCAGCGNCAGRRRRRRRRRRRRRRRRNNNNNNNTGACAGNNNNNNNNAACTCCGTAGCTTCTACATGCGGAAAGTG  lov-5.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  nfa-8.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRANNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  rrs-10.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRACAAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  rrs-7.fa
3378304  GCACTCAGCGGCANRRRRRRRRRRRRRRRRNNNNNNGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  sha.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNNNGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  tamm-2.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNNNGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  ts-1.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNNNNGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  tsu-1.fa
3378304  GCACTCAGCGGCAGRRRRRRRRRRRRRRRRNNNAGGGTGACAGGATTTGCAAACTCCGTAGCTTCTACATGCGGAAAGTG  van-0.fa
 
3378384  AAGTTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCTT  chr1.fa
3378384  AAGNTCNCANAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNATTCAACCCTT  bay-0.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCTN  bor-4.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNAATTCAACCCTT  br-0.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNATTCAACCCTT  bur-0.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNAATTCAACCCTT  c24.fa
3378384  AAGTTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCTN  col-0.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNAATTCAACCCTT  cvi-0.fa
3378384  AAGTNCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCTN  est-1.fa
3378384  AAGTTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCTN  fei-0.fa
3378384  AAGNNNNNNNNNNNNAACTNTAACGAGAAGCTCTCTGCCATTATCGACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  got-7.fa
3378384  AAGNNNNNNNNNTCAAANNNNNNNNANAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACNNNN  ler-1.fa
3378384  ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCATTATCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3378384  AAGTTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNATTCAACCCTN  nfa-8.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNATTCAACCCTN  rrs-10.fa
3378384  AAGTTCNNNNNATCAAANNNNNNCGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCNNN  rrs-7.fa
3378384  AAGNNNNCAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACNNNNNNNNNNNNNNNNNNNNNATTCAACNNNN  sha.fa
3378384  AAGNNNNCAGAATCAANCTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNNTTCAACCCTN  tamm-2.fa
3378384  AAGTTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTTTCCTCGCCTCAAGGAAATTCAACCCNN  ts-1.fa
3378384  AAGNTCNCANAATCAAACNNNNNCGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNNTTCANNNNNN  tsu-1.fa
3378384  AAGNTCACAGAATCAAACTTTAACGAGAAGCTCTCTGCCATTATCGACGAGTNNNNNNNNNNNNNNNNNATTCAACCCTT  van-0.fa
 
3378464  CTATGAAGATCTTCTTCATGTGCTTTACAATAAAGATCACTACAAGCTCGCTCTTGGTCAAGTCAATACTGCGAAGAACA  chr1.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRTCARNNCAAGCTCGCTCTTGGTCAAGTCAANNNGNCGAAGAANN  bay-0.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNNARNACAAGCTCGCTCTTGGTCAAGTCAATACTGCGAAGAACA  bor-4.fa
3378464  CTATGNNNNNNNNNNTCRRRRRRRRRRRRRRRRRRRTCARNACAAGCTCGCTCTTGGTCAAGTCAATACGGCGAAGAACA  br-0.fa
3378464  CTANNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRTCARNACAAGCTCGCTCTTGGTCAAGTCAATACGGCGAAGAACA  bur-0.fa
3378464  CTATNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRTCARNACAAGCTCGCTCTTGGTCAAGTCAATACGGNNANGAACA  c24.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARNACAAGCTCGCTCTTGGTCAAGTCAATACTGCGAAGAACA  col-0.fa
3378464  CNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRTCARTACAAGCTCGCTCTTGGTCAAGTCAATACGGCGAAGAACA  cvi-0.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARTACAAGCTCGCTCTTGGTCAAGTCAATACGGNNANGAACA  est-1.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRTCARNNCAAGCTCGCTCTTGGTCAAGTCAATACGGNNANGAACA  fei-0.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARNACAAGCTCGCTCTTGGTCAAGTNNNNNNGNNNNNNNNNN  got-7.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNNARNNCAAGCTCGCTCTTGGTCAAGTCAATACTGCGAAGAACA  ler-1.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNNNRNNNNANCTCGCTCTTGGTNNNNNNNNNNNGNNNNNNNNNN  lov-5.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARNACAAGCTCGCTCTTGGTCAAGTCAATACGGNNANGAACA  nfa-8.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARTACAAGCTCGCTCTTGGTCAAGTCAATACGNNNAAGAACA  rrs-10.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARNACAAGCTCGCTCTTGGTCAAGTCAATACTGCGAAGAACA  rrs-7.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNNNRNNNNNNNNNGNTCTTGGTCAAGTCNNNNNGNNNNNNNNNN  sha.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNNARNNCAAGCTCGCTCTTGGTCAAGTCAATNNGNNNNNNAACA  tamm-2.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCNRNACAAGCTCGCTCTTGGTCAAGTCAATANGNNNNNNNNNA  ts-1.fa
3378464  NNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRNCARNNCAAGCTCGCTCTTGGTCAAGTCAANNNGNNNNNNAACA  tsu-1.fa
3378464  NNNNNNNNNNNNNCNTCRRRRRRRRRRRRRRRRRRRNCARTACAAGCTCGCTCTTGGTCAAGTCAATACGGCGAAGAACA  van-0.fa
 
3378544  AGATCAGCAAAATCGCCATGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  chr1.fa
3378544  NNATCAGCAAAATCGCCNRGGATTNTGTGAAGCNATTGAAGCATGGTGATTCTNTGTACCGATGCAAGTGCTTAAAAGTG  bay-0.fa
3378544  AGATCAGCAAAATCGCCARGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  bor-4.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  br-0.fa
3378544  ANNNNNGCAAAATCGCCNRGGATTATGTGAAGCNATTGAAGCATGGTGATTCTNTGTACCGATGCAAGTGCTTAAAAGTG  bur-0.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  c24.fa
3378544  AGATCAGCAAAATCGCCARGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  col-0.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  cvi-0.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  est-1.fa
3378544  AGATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  fei-0.fa
3378544  NNATCAGCAAAATCGCCARNGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  got-7.fa
3378544  ANATCAGCAAAATCGCCNRNNNTTNNNNNNNNNNNNTGAAGCATGGTGATTCTCTGNACCGATGCAAGTGCTTAAAAGTG  ler-1.fa
3378544  NNNNNAGCAAAATCGNCNRNNNNNNNNNNNNNNNNNTGAAGCATGGTGATTCTCTGNACCGATGCAAGTGCTTAAAAGTG  lov-5.fa
3378544  AGATCAGCAAAATCGCCARGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  nfa-8.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  rrs-10.fa
3378544  ANATCAGCAAAATCGCCNRGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  rrs-7.fa
3378544  NNATCAGCAAAATCGCCNRGGNTTATGTGAAGCNATTGAAGCATGGTGATTCTNNNNTNNNNTGCAAGTGCTTAAAAGTG  sha.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  tamm-2.fa
3378544  NNANCAGCAAAATCGCCNRGGATTATGTGAAGCNATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  ts-1.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGNNNNGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  tsu-1.fa
3378544  ANATCAGCAAAATCGCCARGGATTATGTGAAGCTATTGAAGCATGGTGATTCTCTGTACCGATGCAAGTGCTTAAAAGTG  van-0.fa
 
3378624  GCTGCTCTTGGGCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  chr1.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCNAGTTTGGCTTATCTTGAACAGGTTAGGCANNNNNN  bay-0.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGNTNNGNAAGGTATTGGTCCTAGTTTGGCTTATCTTGANCAGGTTAGGCAACACAT  bor-4.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANCACAT  br-0.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANCNNNN  bur-0.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  c24.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  col-0.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANCANAT  cvi-0.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTANGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAN  est-1.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANCANAT  fei-0.fa
3378624  GCTGCTCTTGGNCGTATGTGNNNNNNNNNNNNNNNNNTTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANNNNNN  got-7.fa
3378624  GCTGCTCTTGGNCGTATGTGTANNNNNNNNNAANNNNNNNGTCCNAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  ler-1.fa
3378624  GCTGCTCTTGGNCGTATGNNNNNNNNNNNNNNNNNNNNNNNTCNTAGTTTGGCTTATCTTGAACAGGTTAGGNNNNNNNN  lov-5.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANCNNNN  nfa-8.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCNNNNNNN  rrs-10.fa
3378624  GCTGCTCTTGGGCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  rrs-7.fa
3378624  GCTGCTCTTGGNCGTATGTGTNCTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGNNNNNNNNN  sha.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGNNNNNNNNN  tamm-2.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCANNNNNN  ts-1.fa
3378624  GCTGCTCTTGGGCGTATGTGTACNNNNNNNNAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGNNNNNNNNN  tsu-1.fa
3378624  GCTGCTCTTGGNCGTATGTGTACTGTTATGAAAGGTATTGGTCCTAGTTTGGCTTATCTTGAACAGGTTAGGCAACACAT  van-0.fa
 
3378704  TGCAAGGCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTA  chr1.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAANACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTA  bay-0.fa
3378704  TGCAAGGCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTNNNNNNN  bor-4.fa
3378704  TGCCAGGCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAANGANTTNTTNTA  br-0.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTA  bur-0.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTA  c24.fa
3378704  TGCAAGGCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGNNNNNNNN  col-0.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTA  cvi-0.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTNNNNNNN  est-1.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCTTTTN  fei-0.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAANNNNNNNNNNN  got-7.fa
3378704  TGCAAGGCTTCCTTCNATTGATCCAANCACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGNNNNNNNNNN  ler-1.fa
3378704  NNNCNNNNNNNCTTCNATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGANNNNNNNNNNNNN  lov-5.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGANCTCNCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTNNNNNN  nfa-8.fa
3378704  NNNCAGGCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTNNNNNNN  rrs-10.fa
3378704  TGCAAGGCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGANAGAGNNNNNNNN  rrs-7.fa
3378704  NNNCNNNNTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTCNNNNN  sha.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGNNNNNNNN  tamm-2.fa
3378704  NNNCNNNCTTCCTTCGATTGATCCAAACACTCGANCTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGNNNNNNNN  ts-1.fa
3378704  NNNCNNNNTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGNNNNNNNN  tsu-1.fa
3378704  TNNCNNNCTTCCTTCGATTGATCCAAACACTCGAACTCTCTTGATCTGTGGATGTCCTAATGTGGGAAAGAGTTNNNNNN  van-0.fa
 
3378784  TGAACAAAGTTACAAGAGCTGACGTAGCTGTTCAGCCATATGCTTTCACAACAAAGTCACTCTTTCTTGGTCATACTGAT  chr1.fa
3378784  TGAACAAAGTTACAAGAGCTGNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTCTTTCTTGGTRRRRCRGAT  bay-0.fa
3378784  NNNNNNNAGTTACAAGAGCTGACGTAGCTGTTCAGCCATATGCTTTCACAACAAANTCACTCTTTCTTNNNRRRRCRGNT  bor-4.fa
3378784  TGAACAAAGTTACAAGAGCTGNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTCTTTCTTGGTRRRRCRGAT  br-0.fa
3378784  TGAACAAAGTTACAAGAGCTGNTNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTTCTTGGTRRRRCRGAT  bur-0.fa
3378784  TGAACAAAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTTCTTGGTRRRRCRGAT  c24.fa
3378784  NNNNNNNNGTTACAAGAGCTGACGTAGCTGTTCAGCCATATGCTTTCACAACAAAGTCACTCTTTCTTGNTRRRRCRGAT  col-0.fa
3378784  TGAACAAAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTCTTTCTTGGTRRRRCRGAT  cvi-0.fa
3378784  NNNNNNNAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTTCTTGNTRRRRCRGAT  est-1.fa
3378784  TGAACAAAGTTACAAGAGCTNNNNNNNANNNNNNNNNNNNNNNNNNTNNNNNNNNNTCACTCTTTCTTGGTRRRRCRGAT  fei-0.fa
3378784  NNNNNNNAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTCTTNNNRRRRNRGNN  got-7.fa
3378784  NNNNNNNNGTTACAAGAGCTGNNNNNNNNGNNCNGCCATATGCTTTCACNNNNNNNNNNNNNNNTNTNNNNRRRRCRNNN  ler-1.fa
3378784  NNNNNNNNNNTACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRNRNNN  lov-5.fa
3378784  NNNANAAAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTCTTNNNRRRRCRGAT  nfa-8.fa
3378784  NNNNNNAAGTTACAAGAGCTNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTTCTTGGTRRRRCRGAT  rrs-10.fa
3378784  NNNNNNNNGTTACAAGAGCTGACGTAGCTGTTCAGCCATATGCTTTCACAACNNNNNNNCTCTTTCTTNNTRRRRNRGNT  rrs-7.fa
3378784  NNNNNNNAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCTTNNNRRRRCRGNT  sha.fa
3378784  NNNNNAAAGTTACAAGAGNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTTTCTTNNTRRRRCRGNT  tamm-2.fa
3378784  NNNNCAAAGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCTTNNTRRRRCRGAT  ts-1.fa
3378784  NNNNNNNNGTTACAAGAGCNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCTTNNNRRRRNRNNN  tsu-1.fa
3378784  NNNNNNAAGTTACAAGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTCTTTCTTGGTRRRRCRGAT  van-0.fa
 
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAATATCATTGAATT  chr1.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAATATCANNNNNAN  bay-0.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGNTTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTNATNNNNNNNNATT  bor-4.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAANNNNNNNNNNAN  br-0.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACNCCGGGGCTTTTGGATNGGGAAATTGAAGACCGTAATNNNNNNNNNAN  bur-0.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAATATNNNNNNNAN  c24.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAATATCATTGNATT  col-0.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAANNNNNNNNNNAN  cvi-0.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTNNNNNNNNNNNNNN  est-1.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAANNNNNNNNNNAN  fei-0.fa
3378864  TACAAGTGTTTGAGGTATCNNNNNNNTGATACACCGGGGCTTTTGGATNGGGAAATTGAAGACCGTNNNNNNNNNNNNNN  got-7.fa
3378864  TACAAGTGTTTGAGGTATCNNNNNNNNNATACACCGGGGCTTTTGGNTAGGGAAATTGAAGACCGTNNNNNNNNNNNNNN  ler-1.fa
3378864  NNNNNNTGTTTGAGGTATNNNNNNNNNNATACACCGGGGCTTTTGGNNNNNNAAATTGAAGNNNNNNNNNNNNNNNNNAN  lov-5.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATNGGGAAATTGAAGACCGTNNNNNNNNNNNNNN  nfa-8.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTAANNNNNNNNNNNN  rrs-10.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGANTGATACACCGGGGCTTTTGGATNGGGAAATTGAAGACCGTAANNTNNNNNNNNN  rrs-7.fa
3378864  TACAAGTGTTTGAGGTATCAGGNGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGNNNNNNNNNNNNNAN  sha.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTNNNNNNNNNNNNAN  tamm-2.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTNNNNNNNNNNNNAN  ts-1.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATNGGGAAATTGAAGACCGNNNNNNNNNNNNNAN  tsu-1.fa
3378864  TACAAGTGTTTGAGGTATCAGGTGATTGATACACCGGGGCTTTTGGATAGGGAAATTGAAGACCGTANNNNNNNNNNNAN  van-0.fa
 
3378944  GTGTAGCATCACCGCGTTGGCTCATATCCGAGCTGCTGTTTTGTTCTTTCTTGATATTTCGGGTTCTTGTGGTTACACCA  chr1.fa
3378944  NNGTAGCATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNTTNATNTTTCGGNTTCTTGTGGNNNNNNRR  bay-0.fa
3378944  GTGTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGTTACACRR  bor-4.fa
3378944  NNGTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGTTNNNNRR  br-0.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGTTNNNNRR  bur-0.fa
3378944  NNGTAGCATCACCGCGTTGGCTCATATCCGNGCTGCNGRRRRNNNNNNNNNNGATATTTCGGGTTCTTGTGGTTANNNRR  c24.fa
3378944  GTGTAGCATCACCGCGTTGGCTCATATCCGAGCTGNNGRRRRNNNNNNNNNNNATNTTTCGGGTTCTTGTGGTTACACRR  col-0.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNGRRRRNNNNNNNNNNNNNNNNTCGGGTTCTTGTGGNNNNNCRR  cvi-0.fa
3378944  NNNNAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNTTTCGGGTTCTTGTGGNNNNNNRR  est-1.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGNGCTGNNGRRRRNNNNNNNNNNNATNTTTCGGGTTCTTGTGGNNNNNNRR  fei-0.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNNNTCGGGTTCTTGTGGNNNNNNRR  got-7.fa
3378944  NTGTAGCATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNNNNNNNNNTCGGGTNCTTGTGGTTACNCRR  ler-1.fa
3378944  NNNNNNNATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNNNNNNNNNTCGGGTTCTTGTGNNNNNNNRR  lov-5.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGAGCTGNNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGNNNNNNRR  nfa-8.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGTNNNNNRR  rrs-10.fa
3378944  GTGTAGCATCACCGCGTTGGCTCATATCCGNGCTGCNNRRRRNNNNNNNNNNNNNNTTTCGGGTTCTTGTGGTTACACRR  rrs-7.fa
3378944  NNNNAGCATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNNNNNNNNNTCGGGTTCTTGTGGNNNNNNRR  sha.fa
3378944  NNGTAGCATCACCGCGTTGGCTCATATCCGAGCTGNNNRRRRNNNNNNNNNNNNNNNNTCGGGTTCTTGTGGNNNNNNRR  tamm-2.fa
3378944  NNNNNGCATCACCGCGTTGGCTCATATCCGNGCTGNNNRRRRNNNNNNNNNNNNNNNTTCGGGTTCTTGTGGNNNNNNRR  ts-1.fa
3378944  NNNNAGCATCACCGCGTTGGCTCATATCCGAGCTGCNNRRRRNNNNNNNNNNNNNNNNNCGGGTTCTTGTGNNNNNNNRR  tsu-1.fa
3378944  NNNTAGCATCACCGCGTTGGCTCATATCCGAGCTGCNGRRRRNNNNNNNNNNNNTNTTTCGGGTTCTTGTGGTTANNNRR  van-0.fa
 
3379024  TTGCTCAGCAGGCTTCTCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTGATTGTCTGCAACAAGACT  chr1.fa
3379024  RRTNNNNNCAGNNTRNNNTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGNTRATTNNCRRRRRRRRRRRR  bay-0.fa
3379024  RRGCTCAGCAGGCTRCTCTTTTTCACAACANAAAGTCTGTNTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  bor-4.fa
3379024  RRTNNNNNNNNNNNRNTCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  br-0.fa
3379024  RRTNNNNNNNGNNTRNNCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGNRATTGNCRRRRRRRRRRRR  bur-0.fa
3379024  RRTNNCAGCNGNCNRCTCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  c24.fa
3379024  RRGCTCAGCAGGCTRCTCTTTTTCNCAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  col-0.fa
3379024  RRTNNNNNNNNNNNRNNCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  cvi-0.fa
3379024  RRTNNNNNNNNGCNRCTCTTTTTCNCAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  est-1.fa
3379024  RRTNNNNNNNNNNNRCNCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  fei-0.fa
3379024  RRTNNNNNNNNNNNRNNCTTNNNNNNNNNNNNNNNNNNNNNNNNAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  got-7.fa
3379024  RRGCTCAGCAGGCNRCNCTTNNNNNNNNNNNNNNNNNNNNNNNNNAGAACAAACCGTTGGTRATNNNCRRRRRRRRRRRR  ler-1.fa
3379024  RRTNNNNNNNNNNNRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGTTGGTRATNNNCRRRRRRRRRRRR  lov-5.fa
3379024  RRTNNNNNNNNNCNRCNCTTTTTCACAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  nfa-8.fa
3379024  RRTNNNNNNAGNNTRNTCTTTTTCACNNNNNNNNGTCTGTGTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  rrs-10.fa
3379024  RRGCTCAGCAGGCTRCTCTTTTTCNCNNNNNNNAGTCTNNNTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  rrs-7.fa
3379024  RRTNNNNNNNNNNNRNNCTTTTTCACAACANANNNNNTGNNNNNNAGAACAAACCGTTGGTRATTNNNRRRRRRRRRRRR  sha.fa
3379024  RRTNNNNNNNNNNNRNNCTTNNNNNCAACATAANGNNNGTGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  tamm-2.fa
3379024  RRTNNNNNNNNNNNRNNNTTTTTCNCAACATANNNNNNGNGTTCAAGAACAAACCGTTGGTRATTGNCRRRRRRRRRRRR  ts-1.fa
3379024  RRTNNNNNNNNNNNRNNCTTTNNNNNNNNNNNNANTCTNNNNNNAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  tsu-1.fa
3379024  RRTNNNNGCAGGCNRCTCTTTTTCNCAACATAAAGTCTGTGTTCAAGAACAAACCGTTGGTRATTGTCRRRRRRRRRRRR  van-0.fa
 
3379104  GATTTGATGCCTATGGAGAACTTATCTGAAGAAGATAGGAAACTTATTGAAGAGATGAAAGATGAAGCTATGAAGACTGA  chr1.fa
3379104  RRRRRGATGCCTATGGAGAACTTATCTGAAGAAGATAGGAAACTTNTTGAAGAGANGAAAGANGANGCNATGAARRRRRR  bay-0.fa
3379104  RRRRRGATGCCTATGGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNRRRRRR  bor-4.fa
3379104  RRRRRGATGCCTATGGAGAACTTATCNGAAGAAGANANNANNNNNNNNNNNNNNNNNNNNNANGANNNNNNNNARRRRRR  br-0.fa
3379104  RRRRRGANGCCTATGGAGAACTTATCTGAAGAAGATAGGAAACTTNTNNNNNNNNNNNNNNNNGAAGCNATGAARRRRRR  bur-0.fa
3379104  RRRRRGATGCCTATGGAGAACTTATCTGAAGAAGATAGGAAACTTNTTGAAGAGNNNNNAGATGAANNNNNGAARRRRRR  c24.fa
3379104  RRRRRGATGCCTATGGAGAACTTANNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNANGANNNNNNGNARRRRRR  col-0.fa
3379104  RRRRRGATGCCTATGGAGAACTTANCTNAANAAGATAGGAAACNNNNNNNNNNNNNNNNAGATGAAGCNATGAARRRRRR  cvi-0.fa
3379104  RRRRRGNNGCCNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGCTATNAARRRRRR  est-1.fa
3379104  RRRRRGATGCCTACGNNGNACNTANCTGAAGAAGANAGGAAACTTNTTGAAGNNNNNNNAGATGAANNNNNGAARRRRRR  fei-0.fa
3379104  RRRRRGATGCCTATGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRR  got-7.fa
3379104  RRRRRGATGCCTATGGAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNRRRRRR  ler-1.fa
3379104  RRRRRNATGCCTATGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRR  lov-5.fa
3379104  RRRRRGATGCCTATGGAGAACTTNNNNNNNNNNNNTNGGAAACNNNNNNNNNNNNNNNNNNANGANNNNNNGANRRRRRR  nfa-8.fa
3379104  RRRRRGATGCCTATGGAGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGAAGCTATNANRRRRRR  rrs-10.fa
3379104  RRRRRGATGCCTATGGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANGANGCNATNAARRRRRR  rrs-7.fa
3379104  RRRRRGANGCCTATGGAGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRRRRRR  sha.fa
3379104  RRRRRGATGCCTATGGAGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNARRRRRR  tamm-2.fa
3379104  RRRRRGNNGCNNNCNNNNNNNNNNNNNNNAGAANNNNNNNANNNNNNNNNAGAGNNNNNNNNNNNNNNNNNGNNRRRRRR  ts-1.fa
3379104  RRRRRGATGCCTATGGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGANRRRRRR  tsu-1.fa
3379104  RRRRRGATGCCTATGGAGAACTTANCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGATGAAGCNNTGAARRRRRR  van-0.fa
 
3379184  AATGGGAGCAAGTGAAGAAGCAGTGATTTTGGAGATGAGTACTTTGACTGAAGAAGGTGTGATGTCAGTGAGGAATGCTG  chr1.fa
3379184  RRRRRRRGNAAGTGAAGAANNNNNNNNTNNNNNNNNNNGNACTTTGACTGAAGNNNTNNNNNNNNNNGTGAGGAANNNNN  bay-0.fa
3379184  RRRRRRRGNAAGTGAAGAAGCAGTGATTTTGNNNNNNNNNNNNTTGACTGAAGAAGGTGTGATGTCAGTGAGGAATGCTG  bor-4.fa
3379184  RRRRRRRGCAAGTGAAGAAGNNNNNCNNNNNNNNNNNNGNACTTTGACTGANGNNGTTGNGANGTCAGTGAGGAATGCTG  br-0.fa
3379184  RRRRRRRGCAAGTGAAGAAGNNNNNNNNNNNNNNNNGNGTNCTNTGNCTGAAGAAGTNNNNNNNNNNGTGAGGAATGNNN  bur-0.fa
3379184  RRRRRRRGCAAGTGAAGANNNNNNNCNNNNGNNNNNGAGTACTTTGNCTGAAGNNNTNGNGANGTCAGTGAGGAATGCTG  c24.fa
3379184  RRRRRRRGCAAGTGAAGAAGCAGTGATTTTGGNGATGAGTNCTTTGACTGAAGAAGGTGTGATGTCAGTGAGGAATGCTG  col-0.fa
3379184  RRRRRRRGCAAGTGAAGANNNNNNNCNNNNNNNNNNGAGTACTTTGACTGAAGNNNTNNNNNNNTCAGTGAGGAATGCTG  cvi-0.fa
3379184  RRRRRRRGCAAGTGAAGAAGNNNNNCNNNNNNNNNNNAGTACNNNNNNNNNNNNNNNNNNNNNGTCAGTGAGGAATGCTG  est-1.fa
3379184  RRRRRRRGCAAGNGAAGAAGNNNNNCNNNNNNNGATGAGTACNNNNNNNNNNNNNNNNNNNNNNTCAGTGAGGAATGCNG  fei-0.fa
3379184  RRRRRRRGNAAGNGANNNNNNNNNNCNNNNNNNNNNNNGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAANNNNN  got-7.fa
3379184  RRRRRRRGNAAGNNNNGNNNNNNNNATTTTGNNNNNNNNNNNNNTGACTGAAGAAGGTGTGATNNNNNTGAGGAATGCTG  ler-1.fa
3379184  RRRRRRRGNNAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3379184  RRRRRRRNCNAGTGAAGANNNNNNNCNNNNNNNNNNGAGTACTTNNNNNNNNNNNNTNNNNNNNNNNGTGAGGAANNNNN  nfa-8.fa
3379184  RRRRRRRGCAAGTGAAGANNNNNNNCNNNNNNNNNNGAGTACTTTGNCNNANGNNGTNNNNNNNNNAGTGAGGAATGCNG  rrs-10.fa
3379184  RRRRRRRGNAAGNGAAGAAGCNGTGATTTTGNNNNNGNGTNCTTTGACTGAAGAAGGTGTGATGTCNGTGAGGAATGCTG  rrs-7.fa
3379184  RRRRRRRGCNAGTGAAGNNNNNNNNNNNNNNNNNNNGAGTACTTTNNNNNNNNNNNTNNNNNNNNNNNTGAGGAANNNNN  sha.fa
3379184  RRRRRRRNNAAGTGAAGANNNNNNNCNNNNNNNNNNNAGTACTTTNNNNNNNNNNNTNNNGNNNNNAGTGAGGAATGNNN  tamm-2.fa
3379184  RRRRRRRNCNAGTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGAGGAATGNNN  ts-1.fa
3379184  RRRRRRRGNAAGTGAAGNNNNNNNNCNNNNNNNNNNNAGTACTNNNNNNNNNNNNNTNNNNNNNNNAGTGAGGNNNNNNN  tsu-1.fa
3379184  RRRRRRRGCAAGTGAAGAAGNANNNCNNNNNNNNNNGAGTACTTTGANTGAAGAAGTNNNNNNNTCAGTGAGGAATGCTG  van-0.fa
 
3379264  CTTGACAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCCAT  chr1.fa
3379264  NNNNTNNNNGGCTGTTAGATCAGAGGGTAGCGGCGAAGANGAAATCGAAAAAGATCGGTGATCACTTGAACAGNNNNTAT  bay-0.fa
3379264  CTTGACAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCCAT  bor-4.fa
3379264  CTTGTCAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCTAT  br-0.fa
3379264  NNNNTNNNNGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGNNNNTAT  bur-0.fa
3379264  CTTNTNNNAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCTAT  c24.fa
3379264  CTTGACAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCCAT  col-0.fa
3379264  CTTNTNNNAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAANNNNNAAANNNGNNNTNNTCACTTGAACNGGNTCTAT  cvi-0.fa
3379264  CTNNTNNNNGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGNNNTNT  est-1.fa
3379264  CNNNTNNNNNGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGNNNNTAT  fei-0.fa
3379264  NNNNTNNNNNNNNNNNAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTNNNNNNNNNNTNN  got-7.fa
3379264  CTTGACAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAANCGAAAAAGANCGGTGATNACTTGAACAGGTTCCAT  ler-1.fa
3379264  NNNNTNNNNNNNNNNNAGATCAGAGGGTAGCGGCGNNNNTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNN  lov-5.fa
3379264  NNNNTNNNNNNCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGANNNNNNNCTAT  nfa-8.fa
3379264  CNTNTNNNAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGANNNNNNNCTAT  rrs-10.fa
3379264  CTTGACAGAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGANCGGTGANCACTTGAACAGGTTCCAT  rrs-7.fa
3379264  NNNNTNNNNNNNNGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGANCACTTGNNNNNNNNNTAT  sha.fa
3379264  NNNNTNNNNNNNNNNTAGATCAGAGGGTAGCGGCGAAGATGANNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNTAT  tamm-2.fa
3379264  NNNNTNNNNNGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAANCGAAAAAGATCGGTGATCACTTGAANNNNNNNTAT  ts-1.fa
3379264  NNNNTNNNNNNNNNTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGANCACTTGNNNNNNNNNTAT  tsu-1.fa
3379264  CTTNTNNNAGGCTGTTAGATCAGAGGGTAGCGGCGAAGATGAAATCGAAAAAGATCGGTGATCACTTGAACAGGTTCTAT  van-0.fa
 
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGGCTCCCTTGTATACCTCAGGTAGCTGGTGAAAAGGAGAAGCGAAA  chr1.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAANNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  bay-0.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGGCTCCCRRRRNTNCCTCAGGTAGCTGGTGAAAAGGAGAAGCGAAA  bor-4.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  br-0.fa
3379344  GTGGCGATGNCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  bur-0.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNAAA  c24.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGGCTCCCRRRRATACCTCAGGTAGCTGGTGAAAAGGAGAAGCGAAA  col-0.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  cvi-0.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  est-1.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  fei-0.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  got-7.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGGCTCCCRRRRNTNNNNCAGGTAGCTGGTGAAAAGGAGAAGCGAAA  ler-1.fa
3379344  NTGGCGATGCCGAAGAGTCGTGATGACCAAGNNNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGNNNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  nfa-8.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNAAN  rrs-10.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAAAGGCTCCNRRRRATNCCTCAGGTAGCTGGTGAAAAGGAGAAGCGAAA  rrs-7.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGNNNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  sha.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGAANNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  tamm-2.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  ts-1.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGNNNNNNNTNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  tsu-1.fa
3379344  GTGGCGATGCCGAAGAGTCGTGATGACCAAGANNNNNNNNNRRRRNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNN  van-0.fa
 
3379424  GACCGAGAAGGATTTGGAAGATGAAAATGGTGGAGCTGGGGTTTATTCTGCTAGTCTAAAGAAGAACTACATTTTGGCTA  chr1.fa
3379424  NNNNNNGAAGGATTTGGAAGNNGARNNNGGTGNANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRAANNNNNNNTTNNNNN  bay-0.fa
3379424  GACCGAGAAGGATTTGGAAGANNNRNNNGGTGGANNTRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNTACATTTTGNCTA  bor-4.fa
3379424  NACCGAGAAGGNTTTGGANNNNGNRNNNGGTGGAGNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  br-0.fa
3379424  NNNNGAGAAGGNTTTGGANNNNGNRNNNGGTNGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  bur-0.fa
3379424  GACCGAGAAGGATTTGGAAGANGARNNNGGTGGAGCNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  c24.fa
3379424  GACCGAGAAGGATTTGGAAGANGNRNNNGGTGGAGNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNACTACATTTTGGCTA  col-0.fa
3379424  NACCGAGAAGGNTTTGGAAGANGARNNNGGTGGAGCNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  cvi-0.fa
3379424  NACCGAGAAGGATTTGGAAGANGNRANTGGTGGAGCTRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  est-1.fa
3379424  NNNNGAGAAGGNTTTGGAAGANGNRNNNGGTGGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  fei-0.fa
3379424  NNNNNAGAAGGANTNNGNNNNNNNRANTGGTGGAGCTRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  got-7.fa
3379424  GACCGAGAAGGATTTGGAAGANNNRNNNGGTGGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNCTACATTTTGGCNA  ler-1.fa
3379424  NNNNNAGAAGGATTNNNNNNNNNNRNNNGGTGGNNNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  lov-5.fa
3379424  NNNNNAGAAGGATTTGGANGANGNRNNNGGTGGAGNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  nfa-8.fa
3379424  GANCGAGAAGGATTTGGAAGANGARANTGGTGGAGCNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  rrs-10.fa
3379424  GACCGAGAAGGNTTTGGANNNNGNRNNNGGTGGNGNTRRRRRRRRRRRRRRRRRRRRRRRRRRRNNCTACATTTTNNNNN  rrs-7.fa
3379424  NNNNNAGAAGGATNNNNNNNNNNNRNNNGGTGGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  sha.fa
3379424  NNNNNNGAAGGATTTGGAAGANGNRNNNGGTGGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  tamm-2.fa
3379424  NNNNNNGAAGGANTTGGAAGANNNRNNNNGTGGAGNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  ts-1.fa
3379424  NNNNNNGAAGGATTTGGANNNNNNRNNNGGTGGANNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  tsu-1.fa
3379424  NNNNGAGAAGGATTTGGAAGATGARANTGGTGGAGNNRRRRRRRRRRRRRRRRRRRRRRRRRRRNNNNNNNNNNNNNNNN  van-0.fa
 
3379504  AAGAAGAATGGAAGGATGATATAATACCTGAGATCTGTGACTGTCATAATGTTGCTGATTTTGTTGATTCAGACATCTTG  chr1.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGANNNNNNNNNNGNNNNNNNNGTTGCTGATTTTGTTGNNNNNNNNNNTNNG  bay-0.fa
3379504  AAGAAGANNNNNNNNNNNNNNNNNNACCTGAGATCTGTGACTGTCATAATGTTGCTGATTTTGTTGNTTCAGACATCTTG  bor-4.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGAGANNNNNNNNGNNNNNNNNNNTGCTGATTTTGTTGNNNNNNNNNNTNNN  br-0.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGAGNNNNNNNNNGNNNNNNNNNTTGCTGATTTTGTTGNNNNNNNNNNTNNN  bur-0.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGANNNNNNNNNNNNNNNNNNTGTTGCTGATTTTGTTGNNNNNNNNNNTNNG  c24.fa
3379504  AAGAAGAATGGAAGNATGATATAATACCTGAGATCTGTGACTGTCATAATGTTGCTGATTTTGTTGNNNNNGACATCTTG  col-0.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGANNNNNNNNNNNNNNNNNNNNNTGCTGATTTTGTTGNNNNNNNNNNNNNN  cvi-0.fa
3379504  NNNAAGAATGGANNNNTNNTNTAATACCTNNNNNNNNNNNNNNNNNNNNNNNTGCTGATTTTGTTNNNNNNNNNNNTNNN  est-1.fa
3379504  NNGAAGAATGGAAGGATGATATAATACCTGANNNNNNNNNNNNNNNNNNNGTTGCTGATTTTGTTGNNNNNNNNNNTNNN  fei-0.fa
3379504  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATTTTGNNNNNNNNNNNNNTNNN  got-7.fa
3379504  NNNNNNNNNNNNNNNNTGNNNNNNNNNNTGAGATCTGTGACTGTCATNATGTTGCTGNTTTTGTTGNTTNANNCATCTTG  ler-1.fa
3379504  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNN  lov-5.fa
3379504  NNNNAGAATGGAAGGATGATATAATACCTNNNNNNNNNNNNNNNNNNNNNNTTGCTGATTTTGTTGANNNNNNNNNTNNN  nfa-8.fa
3379504  NNNAAGAATGGAAGGATGATATAATACCNNNNNNNNNNNNNNNNNNNNNNNNNGCTGATTTTGNNNNNNNNNNNNNTNNN  rrs-10.fa
3379504  NAGAAGAATNNNNNNNTGATNNNNTACCTGAGATCTGTGACTGTCATAATGTTGCTGATTTTGTTGNTTCAGACATCTTG  rrs-7.fa
3379504  NNNNAGAATGGNAGGATGATATANTACCTGNNNNNNNNNNNNNNNNNNNNNNTGCTGATTTTGTTNNNNNNNNNNNTNNN  sha.fa
3379504  NNGAAGAATGGNNNNNTGATATAATACCTGNNNNNNNNNNNNNNNNNNNNNNNGCTGNTTTTGTTNNNNNNNNNNNTNNN  tamm-2.fa
3379504  NNNAAGAATGGAAGGATGATATAATACCTNNNNNNNNNNNNNNNNNNNNNNNTGCTGNTTTTGTTNNNNNNNNNNNTNNN  ts-1.fa
3379504  NNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCNGATTTTGNNNNNNNNNNNNNTNNN  tsu-1.fa
3379504  NNNAAGAATGGAAGGATGATNTNATACCTGANNNNNNNNNNGNNNNNNNNNTTGCTGATTTTGTTGNNNNNNNNNNNNNN  van-0.fa
 
3379584  AATAGGCTTGAGGAATTGACAAGTGAAGAAAGTCTTAGGAAGGCAGAGGAAGAAGAAGTTGGTTTTGAGATTGAAGGCGA  chr1.fa
3379584  AATNNNNTTGAGGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAAGNNNNRTTNNNNNNNNNNNNNNN  bay-0.fa
3379584  AATAGGCTTGAGGAATTGACAAGTGAAGAAAGTCTTAGGAAGGCAGNNNNNGAAGANGTNGNRNTTGAGATTGAAGGCGA  bor-4.fa
3379584  NNNNNNNNNNAGGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAAGNNGGRTNNGNGANNNNNNNNNN  br-0.fa
3379584  AATNGGCTTGAGNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNGGRNNNNNNNNNNNNNNNNN  bur-0.fa
3379584  AATAGGNTTGAGGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGAAGTNGGRNNNGNGANNNNNNNNNN  c24.fa
3379584  AATAGGCTTGAGGAATTGACAAGTGAAGAAAGTCTTAGGAAGGCAGANGAAGAAGAAGNNNGRNNTGAGATTGAAGGCGA  col-0.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAAGTNGNRNNNGNGANNNNNNNNNN  cvi-0.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGNAGTNGGRTNNGANNNNNNNNNNNN  est-1.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNAGAAGAAGNNGGRNTNGAGANNNNNNNNNN  fei-0.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGANNNNNNNNNRNNNNNNNNNNNNNNNNN  got-7.fa
3379584  AATAGGCTTGAGGAATTGACAAGTGAAGAAAGTCTTAGGAAGGNNNNNNNNNNNNNNNNNNNRTNNGAGATTGAAGGCGA  ler-1.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNN  lov-5.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNGNGNNNNNNNNNNN  nfa-8.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGAAGTTGGRTNNGAGANNNNNNNNNN  rrs-10.fa
3379584  AATAGGCTTGAGGAATTGACAAGTGAAGAAAGTCTTAGGAAGNNNNNNNNAGAAGAAGTNNGRTNTGAGATTGAAGGCGA  rrs-7.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNAGTNNNRNNNNNNNNNNNNNNNNN  sha.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGNNNNNGNRNNNGNNNNNNNNNNNNN  tamm-2.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGANNNNNNNNNRNNNGAGNNNNNNNNNNN  ts-1.fa
3379584  NNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNRNNNNNNNNNNNNNNNNN  tsu-1.fa
3379584  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAAGNTGNRTNNGAGANNNNNNNNNN  van-0.fa
 
3379664  AGAACTTACAGAGAAGGAGAAGAATGATTTGGCTGCTATTCGTAAGAAGAAAGCTTTGCTTATTGAAGAGAGTAGACTTA  chr1.fa
3379664  NNNNNTTACAGAGANNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNCTTA  bay-0.fa
3379664  AGAACTTACANNNNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAANNNNNNNNNNNTTATTGAANNNNNNNNACTTA  bor-4.fa
3379664  NNNNNNNNNAGNNNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNTTA  br-0.fa
3379664  NANNNTTACAGAGANNNNGAAGAATGATTTGGCTGCTATTCGTAAGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNCTTA  bur-0.fa
3379664  NNNNNTTACAGAGANGGAGAAGAATGATTTGGCTGCTATTCGTAAGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNCTTA  c24.fa
3379664  AGAACTTACAGNNNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGNNNNNNNNGCTTATNGAAGAGAGTAGACTTA  col-0.fa
3379664  NNNNNNNNCAGAGNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNCTTA  cvi-0.fa
3379664  NNNNNNNNNANAGNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  est-1.fa
3379664  NNNNNNNNCAGAGNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNCTTA  fei-0.fa
3379664  NNNNNNNNNNNNNNNNNNNNNNNATGATTTGGCTGCTATTCGTAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA  got-7.fa
3379664  AGAACTTACANNNNNNNNNNNNAATGATTTGGCTGCTATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTA  ler-1.fa
3379664  NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCTGCTATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN  lov-5.fa
3379664  NNNNNNNNNANANNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  nfa-8.fa
3379664  NNNNNNNNCAGAGANNNNNNAGAATGATTTGGCTGCTATTCGTAAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  rrs-10.fa
3379664  AGAACTTACAGNNNNNNNNNAGAATGATTTGGCTGCTATTCGTAANANNNNNNNNNNNNNNNTTGAAGAGAGTNGACTTA  rrs-7.fa
3379664  NNNNNNNNNNNNNNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  sha.fa
3379664  NNNNNNNNCAGANNNNNNNNAGAATGATTTGGCTGCTATTCGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  tamm-2.fa
3379664  NNNNNNNNNNNNNNNNNNNNNGAATGATTTGGCTGCTATTCGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  ts-1.fa
3379664  NNNNNNNNNNNNNNNNNNNNNNAATGATTTGGCTGCTATTCGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTA  tsu-1.fa
3379664  NNNNNNNNNNNNNNNNNNNNAGAATGATTTGGCTGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA  van-0.fa
 
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCTGTTCCAAGAAAGTTTGACAAGGATAAGAAGTTTACAAGGAAGAGAATGGGT  chr1.fa
3379744  AGAAGAGCANNNNNNAAAACAGAGCAGCNGTTCCAAGAARGNNNNNRNNANNNNNNAAGTTTACAAGGAAGAGAATGGGN  bay-0.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCTGTTCCAAGAARGTNTGARNNNNNNNNNNNNNNNNNNNGGAAGAGAATGGGN  bor-4.fa
3379744  AGAAGAGCAATNCACAAAACAGAGCAGCTGTTCCAANNNRNNNNNNRNNNNNNNNNNNNNNNNCAAGGAAGAGAATGGGN  br-0.fa
3379744  AGAAGAGCAATNCACAAAACAGAGCAGCNGTTCCAAGANRNNNNNNRNNANNNNNNNNNNNTACAAGGAAGAGAATGGGN  bur-0.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCTGTTCCAAGAARNNNNNNRNNANNNNNNNNNNNTACAAGGAAGAGAATGGGN  c24.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCNGTTCCAANAARGNTTGARNNNGATAAGAAGNNNNNNNGGAAGAGAATGGGN  col-0.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCTGTTCCAAGAARNNNNNNRNNNNNNNNNNNNNNTACAAGGAAGAGAATGGGN  cvi-0.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCTGTTCCAAGAARNNNNNNRNNNNNNNNNNNNNNNNNNAGGAAGAGAATGGGN  est-1.fa
3379744  AGAAGAGCAATGCACAAAACAGAGCAGCNGTTCCAAGAARNNNNNNRNNANNNNNNNNNNNNN